View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_86 (Length: 290)
Name: NF10163A_low_86
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_86 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 11213871 - 11214133
Alignment:
| Q |
1 |
gaaggagaatgggttggaggaagatgggtttgttcctgtgttgaatttgaaggtgttttcgtacaaggagcttcaattggcgactcgagggttttctgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11213871 |
gaaggagaatgggttggaggaagatgggtttgttcctgtgttgaatttgaaggtgttttcttacaaggagcttcaattggcgactcgagggttttctgag |
11213970 |
T |
|
| Q |
101 |
aaacttgggcatggtgggtttgggacggtgtttcaaggggagttgagtgattctactgttgttgctgtgaaacgtttagagaggccgggaggtggagaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11213971 |
aaacttgggcatggtgggtttgggacggtgtttcaaggggagttgagtgattctactgttgttgctgtgaaacgtttagagaggccgggaggtggagaga |
11214070 |
T |
|
| Q |
201 |
aagagtttagggctgaggtttcaacgattgggaacattcagcatgttaatcttgtgaggttaa |
263 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11214071 |
aagagtttagggctgaggtttcaacaattgggaacattcagcatgttaatcttgtgaggttaa |
11214133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University