View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_87 (Length: 289)
Name: NF10163A_low_87
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_87 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 7 - 269
Target Start/End: Complemental strand, 29584183 - 29583921
Alignment:
| Q |
7 |
ctaaatatcgtgtcaaatccttccatgtttgacaagtaaatttggtttgtactttatgttaacaaataattttgttatcttgaaaaagctttgattctac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29584183 |
ctaaatatcgtgtcaaatccttccatgtttgacaagtaaatttggtttgtactttatgttaacaaataattttgttatcttgaaaaagctttgattctac |
29584084 |
T |
 |
| Q |
107 |
atttgtggtgtgcatgtagagatgcagatttagttcaaagaattggagctgcaacatcacttgaacttagagcaagtggaactcactatacttgtgctcc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29584083 |
atttgtggtgtgcatgtagagatgcagatttagttcaaagaattggagctgcaatatcacttgaacttagagcaagtagaactcactatacttgtgctcc |
29583984 |
T |
 |
| Q |
207 |
ttgtgtggctgtaaggcatcataaccaacttatgaatttgctacgctgattaactacagcttt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
29583983 |
ttgtgtggctgtaaggcatcataaccaacttctgaatttgctacgttgattaactacagcttt |
29583921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 121 - 224
Target Start/End: Original strand, 29610626 - 29610729
Alignment:
| Q |
121 |
tgtagagatgcagatttagttcaaagaattggagctgcaacatcacttgaacttagagcaagtggaactcactatacttgtgctccttgtgtggctgtaa |
220 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||||||||| || ||| |||| |||||| |
|
|
| T |
29610626 |
tgtagagatgcagatttagttcaaaaaattgcagctgcaacgtcacttgaacttagagcaagtggaactcactatactttagcccctagtgtatctgtaa |
29610725 |
T |
 |
| Q |
221 |
ggca |
224 |
Q |
| |
|
|||| |
|
|
| T |
29610726 |
ggca |
29610729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 123 - 225
Target Start/End: Complemental strand, 25128882 - 25128780
Alignment:
| Q |
123 |
tagagatgcagatttagttcaaagaattggagctgcaacatcacttgaacttagagcaagtggaactcactatacttgtgctccttgtgtggctgtaagg |
222 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||| | |||||| ||| |||||| |||| |||||||| | |||||||||||| || |||||| |
|
|
| T |
25128882 |
tagagatgctgatttagttagaagaattggagctgcaacggcgcttgaagttaaagcaagcggaattcactataactttgctccttgtgtcgcggtaagg |
25128783 |
T |
 |
| Q |
223 |
cat |
225 |
Q |
| |
|
||| |
|
|
| T |
25128782 |
cat |
25128780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University