View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163_low_14 (Length: 248)
Name: NF10163_low_14
Description: NF10163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 24 - 235
Target Start/End: Original strand, 51388836 - 51389047
Alignment:
| Q |
24 |
agcttcacaacaaagtccacacacccactttccacaataatcttcttcaacttcattcatataaactttgctacattcttctttcatcccacaacattgg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51388836 |
agcttcacaacaaagtccacacacccactttccacaataatcttcttcaacttcattcatataaactttgctacattcttctttcatcccacaacattgg |
51388935 |
T |
 |
| Q |
124 |
cattcagcttcttctaactcttcaatgtcatcaaattttctttctacttccaagctatagtatttgttaatttcttgagacacgtccgagaccgcctttc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51388936 |
cattcagcttcttctaactcttcaatgtcatcaaattttctttctacttccaagctatagtatttgttaatttcttgagacacgtccgagaccgcctttc |
51389035 |
T |
 |
| Q |
224 |
gtagcctttgct |
235 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51389036 |
gtagcctttgct |
51389047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University