View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163_low_3 (Length: 530)
Name: NF10163_low_3
Description: NF10163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 356; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 144 - 511
Target Start/End: Original strand, 1329719 - 1330086
Alignment:
| Q |
144 |
ttgtgcaaaccgagggtgatttgttgaacttaggagatgatagagtgacaactgaagaacatggggacaaacttgccttagctttatttgatggggctgc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1329719 |
ttgtgcaaaccgagggtgatttgttgaacttaggagatgatagagtgacaactgaagaacatggggacaaactagccttagctttatttgatggggctgc |
1329818 |
T |
|
| Q |
244 |
accagcaacaagtgaaggtggaataaaagcacttccatggcatgcatttgacgagagtgcagattgggaaacagcgttggtacaatcaaccagccactta |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329819 |
accagcaacaagtgaaggtggaataaaagcacttccatggcatgcatttgatgagagtgcagattgggaaacagcgttggtacaatcaaccagccactta |
1329918 |
T |
|
| Q |
344 |
ggaaaccagcagcctgcattaggtggaggctttgatacattattgttggatggtatgtataaacaaggagaaatgaatgcagccatgcaaggagtgggat |
443 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329919 |
ggaaaccagcagcctgcattaggtggaggctttgatacattattgttggatggtatgtataaacaaggagaaatgaatgcagccatgcaaggagtgggat |
1330018 |
T |
|
| Q |
444 |
atggttgcagtggaagtgctagcagtgtagcacttggttcagccggaaggccagcaatgctagcattg |
511 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1330019 |
atggtggcagtggaagtgctagcagtgtagcacttggttcagccggaaggccagcaatgctagcattg |
1330086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 18 - 94
Target Start/End: Original strand, 1329593 - 1329669
Alignment:
| Q |
18 |
aggaacccgaacccgaacctgaaccggaagaggatatgaatgaagtcaaggcccttccaccaccagaggaaccagcc |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1329593 |
aggaacccgaacccgaacctgaaccggaagaggatatgaatgcagtcaaggcccttccaccaccagaggaaccagcc |
1329669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University