View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163_low_6 (Length: 395)
Name: NF10163_low_6
Description: NF10163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 7e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 18 - 143
Target Start/End: Original strand, 18796077 - 18796202
Alignment:
| Q |
18 |
agaacatcttgtataaatgtgtgatgcaagtaataaaatttagtagtgtgttgtgatcattgttatcttggcaatcatctcataccataacattcaaatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18796077 |
agaacatcttgtataaatgtgtgatgcaagtaataaaatttagtagtgtgttgtgatcattgttatcttggcaatcatctcataccataacattcaaatc |
18796176 |
T |
|
| Q |
118 |
actctaaaagtgtgccatcatcaatt |
143 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
18796177 |
actctaaaagtgtgccatcatcaatt |
18796202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University