View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10164_high_2 (Length: 238)
Name: NF10164_high_2
Description: NF10164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10164_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 1140395 - 1140475
Alignment:
| Q |
1 |
ctatggaacccatctctctctagtgtgaaagtttccattttaatatcaaaagagaaatacatgtgaaagttagtttgagtc |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1140395 |
ctatggaacccatctctctctagtgtgaatgtttcttttttaatatcaaaagagaaattcatgtgaaagttagtttgagtc |
1140475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 153 - 223
Target Start/End: Original strand, 1140636 - 1140706
Alignment:
| Q |
153 |
agaggtgggatatgattggtatgcaacgcttttgttatttagaaaccatgttatgaagtgaagtgtgtttg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
1140636 |
agaggtgggatatgattggtatgcaacgcttttgttttatagaaaccatgttatgaagtgaagtgtgtttg |
1140706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 78 - 139
Target Start/End: Original strand, 1140516 - 1140577
Alignment:
| Q |
78 |
agtccctgcatccaatcaatgacaaccaaatagttagaaagaaagaaacagttatatcaaaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||| |
|
|
| T |
1140516 |
agtccctgcatccaatcaatgacaaccaaatagttataaagaaagaaacatttatattaaaa |
1140577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University