View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10164_low_11 (Length: 288)
Name: NF10164_low_11
Description: NF10164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10164_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 40 - 281
Target Start/End: Complemental strand, 36933710 - 36933470
Alignment:
| Q |
40 |
gcaaaaatatgtttaattcagttgaacggatggttaactcaattcacattgaaaattgtgattatgaccagtgataaatcaaaatcaatataacatgttc |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36933710 |
gcaaaaatatgtttaattcagttgaacggatgattaactcaatttacattgaaaattgtgattatgaccgatgataaatcaaaatcaatataacatgttc |
36933611 |
T |
|
| Q |
140 |
aaagtcgatcatgtttaagctttgtaaagtctaatctattctcagctatacaaacaaaagtgattgtgttttttgttttcatttatttctaggactttga |
239 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| || ||| |||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
36933610 |
aaagtcaatcatgtttaagctttgtaaagtctaatctattctcatctttactaacaaaagtgattgtg-catttgttttcatttatttctaggcctttga |
36933512 |
T |
|
| Q |
240 |
gcgaagaattggctggcatggcatcaatttggatctctgctc |
281 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
36933511 |
gcgaagaattggctggtatggcatcaatttggatttctgctc |
36933470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University