View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10164_low_7 (Length: 363)
Name: NF10164_low_7
Description: NF10164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10164_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 25 - 356
Target Start/End: Original strand, 53682490 - 53682821
Alignment:
| Q |
25 |
caattggacacatatttgaggacgaaagattataatttttaacatgatttaatttaacgtttaatgatcgaaaataaaaaatggatgggtgaaagcttac |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
53682490 |
caattggacacatatttgaggacgaaagattataatttttaacatgatttaatttatcgtttaatgatcgaaaaaaaaaaatggatgggtgaaagcttac |
53682589 |
T |
|
| Q |
125 |
aaaatgccttcagcagagccaattgcaatgctcattctcttttgccagttgagttgcacttcaccagcatattgaccatggagatgagaaagcagactta |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682590 |
aaaatgccttcagcagagccaattgcaatgctcattctcttttgccagttgagttgcacttcaccagcatattgaccatggagatgagaaagcagactta |
53682689 |
T |
|
| Q |
225 |
gatttggcatgtaatcatagacaataagcctttgatcatcgccaacacaatagccccttagacctaacaaatttttgtgcctaacccttccaagcacttc |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682690 |
gatttggcatgtaatcatagacaataagcctttgatcatcgccaacacaatagccccttagacctaacaaatttttgtgcctaacccttccaagcacttc |
53682789 |
T |
|
| Q |
325 |
aacttctacagcaaattccatctctgcctttg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
53682790 |
aacttctacagcaaattccatctctgcctttg |
53682821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 287 - 357
Target Start/End: Original strand, 46146645 - 46146715
Alignment:
| Q |
287 |
cctaacaaatttttgtgcctaacccttccaagcacttcaacttctacagcaaattccatctctgcctttgc |
357 |
Q |
| |
|
||||||||||| || ||||| |||||||| || ||||| ||||| || ||||||||||||||||| ||||| |
|
|
| T |
46146645 |
cctaacaaattcttatgcctcacccttcctagtacttccacttcaactgcaaattccatctctgcttttgc |
46146715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University