View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10164_low_8 (Length: 349)
Name: NF10164_low_8
Description: NF10164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10164_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 53 - 161
Target Start/End: Complemental strand, 31268872 - 31268764
Alignment:
| Q |
53 |
atagattatgtccactagaggtaaatagatactctttttcgatccggatttaagccataatttacgtctaaccttttctgttagattcaatcctgttggc |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31268872 |
atagattatgtccactagaggtaaatagatactctttttcgatccggatttaagccataatttacgtctaaccttttcttttagattcaatcctgttggc |
31268773 |
T |
|
| Q |
153 |
aaaaccact |
161 |
Q |
| |
|
||||||||| |
|
|
| T |
31268772 |
aaaaccact |
31268764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University