View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10165_high_4 (Length: 395)
Name: NF10165_high_4
Description: NF10165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10165_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 7 - 349
Target Start/End: Complemental strand, 48286581 - 48286239
Alignment:
| Q |
7 |
ataagcaccgtcggattttgtggttatgttgaaacttggaacacggaaggaaccgaggtggaattctggtatggaaggttgatagagaatgtagataact |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48286581 |
ataagcaccgtcggattttgtggttatgttgaaacttggaacacggaaagaaccgaggtggaattctggtatggaaggttggtagagaatgtagataact |
48286482 |
T |
|
| Q |
107 |
gcggcggcgaggatgaaaaggaagaagagaatgaggaagatgatgcaaaatgtgcaacaacataggcgacaataattacgtttcttgggttttggtcgga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286481 |
gcggcggcgaggatgaaaaggaagaagagaatgaggaagatgatgcaaaatgtgcaacaaaataggcgacaataattacgtttcttgggttttggtcgga |
48286382 |
T |
|
| Q |
207 |
aagaaggtgggagagaagggtttcgtgttggaagcggtttttgttggatgtttgggtctctataacaaggtggttttggtagtattattggtttttgttc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286381 |
aagaaggtgggagagaagggtttcgtgttggaagcggtttttgttggatgtttgggtctctataacaaggtggttttggtagtattattggtttttgttc |
48286282 |
T |
|
| Q |
307 |
gggcgatggttgctgcattgtgattttgtgttaatgatgattt |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286281 |
gggcgatggttgctgcattgtgattttgtgttaatgatgattt |
48286239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University