View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10165_high_5 (Length: 326)
Name: NF10165_high_5
Description: NF10165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10165_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 20 - 316
Target Start/End: Complemental strand, 3570996 - 3570696
Alignment:
| Q |
20 |
taaaggacgaaggcactctaatgaccggatg----aacaaacagattaaaaccaaacacaactccggtaaacctaaaaggtcttcgacactattgagcct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3570996 |
taaaggacgaaggcactctaatgaccggatggatgaacaaacagattaataccaaacacaattccggtaaacctaaaaggtcttcgacgctattgagccc |
3570897 |
T |
 |
| Q |
116 |
agagggaaacggctcactgaattaccgtgcggccaaacaatctgaagaatgcaccacaccattccactccacaacattattgcagttgcaggtgcccttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || || |
|
|
| T |
3570896 |
agagggaaacggctcactgaattaccgagcggccaaacaatctgaagaatgcaccacaccactccactccacaacattattgcagttgcaggtgaccctc |
3570797 |
T |
 |
| Q |
216 |
aaaaagtacaaatatattattaccagacaagacaatagatttaaaggtttctagagaaataataattgttattctgttggagtaacctcacgctgtctct |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3570796 |
aaaaagtacaaatatattattaccagacaagacaatagaattaaaggtttctagagaaataataattgttattctgttggagtaacctcacgctgtctct |
3570697 |
T |
 |
| Q |
316 |
g |
316 |
Q |
| |
|
| |
|
|
| T |
3570696 |
g |
3570696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University