View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10165_high_9 (Length: 266)
Name: NF10165_high_9
Description: NF10165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10165_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 11287993 - 11287735
Alignment:
| Q |
1 |
aatacttagataaaaccacacactactttccttcactgtttcttgttccattccatctctttctgccaacac--------tttgttttctctctacctta |
92 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11287993 |
aatacatagataaaaccacacactactttccttcactgtttcttgttccattccatctctttctgccaacaccttctctctttgttttctctctacctta |
11287894 |
T |
 |
| Q |
93 |
ccatcttccaccttcaacctctctttcaactctttaaccattttctatgaaagtgagtggaggctctcttggtcaagagagcctgcacagtgaagaagaa |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11287893 |
ccatcttccaccttcaacctctctttcaactctttaaccattttctatgaaagtgagtggaggctctcttggtcaagagagcctgcacagtgaagaagaa |
11287794 |
T |
 |
| Q |
193 |
gagccaaactagcttcatcattttcataaactttcttaccttttttcatataaaaaact |
251 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
11287793 |
gagccaaactagcttcatcattttcacaaactttcgtaccttttttcatataaaaaact |
11287735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University