View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10165_low_7 (Length: 368)
Name: NF10165_low_7
Description: NF10165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10165_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 26 - 357
Target Start/End: Complemental strand, 26126447 - 26126116
Alignment:
| Q |
26 |
tgcaaggaagccccttcctccaccttatttattgccagttttccatggggtaccgctaagttccctcatccagtcatctcagtaaaaagattttatattt |
125 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26126447 |
tgcaagggagccccttcctccaccttatttattgccagttttccacggggtgccgctaagttccctcatccagtcatcccagtaaaaagattttatattt |
26126348 |
T |
|
| Q |
126 |
ttaggttagaagaaagatttggagtaggaaatatattgttggaatcacataaatgatgttgttcaaaagacgaaggtgtaagaaatagttcacatgtttt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
26126347 |
ttaggttagaagaaagatttggagtaggaaatatattgttggaatcacataaatgatgtagttcaaaagacgaaggcgtaagaaatagttcacgtgtttt |
26126248 |
T |
|
| Q |
226 |
ggtcgggaggaaagatatgatgctacaaaacactctatcggactttgtgccttacgacattctatctttactactgatcaaaacatgtgtaggctacgat |
325 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26126247 |
ggtcgggaggaaagataggatgctacaaaacactctatcggactttgtgccttacgacattctatctttactactgatcaaaacatgtgtaggctacgat |
26126148 |
T |
|
| Q |
326 |
gagctatgtctctcaccggtggcatcaccttt |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26126147 |
gagctatgtctctcaccggtggcatcaccttt |
26126116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University