View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10166_high_9 (Length: 238)
Name: NF10166_high_9
Description: NF10166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10166_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 31292614 - 31292395
Alignment:
| Q |
1 |
taaaaaccaccttcagcaactccaacaacaccatagaacccgcttctcgcgactctttttatcgtgcatagatcaatggcaacgtttatgggaactaagt |
100 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
31292614 |
taaaaaccaccttcagaaactccaaca---ccatagaacccgcttctcccgactctttttatcgtgcatagatcaatgacaacgtttatggaaactaagt |
31292518 |
T |
|
| Q |
101 |
tcttgtaacttcgttccctcggcttaccaaaataatagttgg-aaaaggtgtgaaatcttccaagatagctagatccatcatagcaactccacatgctga |
199 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
31292517 |
tcttgtaactttgttcccttggcctaccaaaataatagttggaaaaaggtgtgaaatcttccaaaatagctagatctatcatagcaactccacatgttga |
31292418 |
T |
|
| Q |
200 |
actcggtgattggagtgtcataa |
222 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
31292417 |
actcgacgattggagtgtcataa |
31292395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University