View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10166_low_20 (Length: 229)
Name: NF10166_low_20
Description: NF10166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10166_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 1e-58; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 52886036 - 52886154
Alignment:
| Q |
1 |
tttttacttatctttatttaattagatgagacaagatctagcatgtgaattgtataattaatttatgtttagtaaaattgattttgatttaaaggtgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52886036 |
tttttacttatctttatttaattagatgagacaagatctagcatatgaattgtataattaatttatgtttagtaaaattgattttgatttaaaggtgaat |
52886135 |
T |
|
| Q |
101 |
ctaatgtgagataatttat |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
52886136 |
ctaatgtgagataatttat |
52886154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 52885727 - 52885796
Alignment:
| Q |
1 |
tttttacttatctttatttaattagatgagacaagatctagcatgtgaattgtataattaatttatgttta |
71 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||||||||||||||| ||||||| || ||||||||||||||| |
|
|
| T |
52885727 |
tttttacttatctatatttgattagatg-gacaagatctagcatatgaattgaatgattaatttatgttta |
52885796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 189 - 224
Target Start/End: Original strand, 52886781 - 52886816
Alignment:
| Q |
189 |
tatatcaaacttagtataactctatatgataaagtt |
224 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52886781 |
tatatcaaacttagtataactctatacgataaagtt |
52886816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University