View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10167_high_21 (Length: 239)
Name: NF10167_high_21
Description: NF10167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10167_high_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 2 - 222
Target Start/End: Original strand, 30059397 - 30059621
Alignment:
| Q |
2 |
ttatctctctcaaattctcacctgcttattctatcattatacattatctataactaactacggctaagctcacccttcctcactcattacctcactactc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30059397 |
ttatctctctcaaattctcacctgcttattctatcattatacattatctacaactaactacggctaagctcacccttcctcactcattacctcactactc |
30059496 |
T |
 |
| Q |
102 |
atttacttctttttagaatagattttccatattttagggattccatataatggaatgaaatgtatcatataaagaatcga----gatgtttactgttgtt |
197 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30059497 |
atttacttctttttagaatagactttccatattttagggattccatataatggaatgaaatgtatcatataaagaatcgagatcgatgtttactgttgtt |
30059596 |
T |
 |
| Q |
198 |
gaaggtattggctagagatgtaaaa |
222 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
30059597 |
gaaggtattggctagagatgtaaaa |
30059621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 135
Target Start/End: Original strand, 15061959 - 15062023
Alignment:
| Q |
71 |
tcacccttcctcactcattacctcactactcatttacttctttttagaatagattttccatattt |
135 |
Q |
| |
|
|||| |||| |||||||||||||||| |||||||| || ||| ||||||||| ||||||||||| |
|
|
| T |
15061959 |
tcacgcttcttcactcattacctcacaactcattttctcttttctagaatagactttccatattt |
15062023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University