View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10167_high_22 (Length: 238)
Name: NF10167_high_22
Description: NF10167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10167_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 105 - 223
Target Start/End: Complemental strand, 26322164 - 26322044
Alignment:
| Q |
105 |
aactcttgaagttaagataaacgttaagagcatgtggttaagcatataggccaaagtgaggaattcacgaagaa-ttaattcaggaattaaactactaat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
26322164 |
aactcttgaagttaagataaacgttaagagcatgtggttaagcatataggccaaagtgaggaattcacgaagaatttaattcaggaatgaaactactaat |
26322065 |
T |
 |
| Q |
204 |
t-aaaagatagtagtcataag |
223 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
26322064 |
taaaaagatagtagtcataag |
26322044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 26322272 - 26322197
Alignment:
| Q |
1 |
aaaatgacacatagctttcaaactacttcataattaatattctattcactccaatccctcaaaactctcaatcaca |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26322272 |
aaaatgacacatagctttcaaactacttcataattaatattctattcactccaatccctcaaaactctcaatcaca |
26322197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University