View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10167_low_20 (Length: 347)
Name: NF10167_low_20
Description: NF10167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10167_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 20 - 337
Target Start/End: Original strand, 589525 - 589840
Alignment:
| Q |
20 |
cccataacccttcaagccatcaaaccttgctgtcttcaacggtttggtaaggatatctgcaagttgcaactctaacttgcaatactcaatctctaatctg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
589525 |
cccataacccttcaagccatcaaaccttgctgtcttcaacggtttggtaaggatatctgcaagttgcaactctaacttgcaatactcaatctctaatctg |
589624 |
T |
 |
| Q |
120 |
tctttattcacttgatctctcaaaaagtgatatttcatgtcaatattctctctcttttatcatgactcataggatgattagataggtcaattattgattt |
219 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| || ||||| | ||||||| |
|
|
| T |
589625 |
tctttattcacttgatctcttaaaaagtgatatttcatgtcaatattctctctc--ttaccatgactcataggatgattagctaagtcaactgttgattt |
589722 |
T |
 |
| Q |
220 |
gttatcaacaagtagcataatcttctcattttcaatgacctttatcttatttccgaggaaaacatttatacaattactattttaataaaatcatcaacaa |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
589723 |
gttatcaacaagtagcataatcttctcattttcaatgacctttatcttatttcctaggaaaacatttatacaattactattttaataaaatcatcaacaa |
589822 |
T |
 |
| Q |
320 |
tatatcagtgatcctatg |
337 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
589823 |
tatatcagtgatcctatg |
589840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University