View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10167_low_29 (Length: 292)
Name: NF10167_low_29
Description: NF10167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10167_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 9 - 276
Target Start/End: Complemental strand, 37644280 - 37644014
Alignment:
| Q |
9 |
atcaccataaacttcaccaaccttagccaccgttccgtccatacacgctaattaaccgctccggaccgacacattaaggcacataacaaccgtaacgcca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||| |||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
37644280 |
atcaccataaacttcaccaaccttagccaccgtccc-tccatacacactaattaaccgctccggaccaacacattagagcacataacaaccgtaacgcca |
37644182 |
T |
 |
| Q |
109 |
gacgtgaactacggctttattacggcgaccttttctcctttcttgcaacgctatggcacttgcatttgattatcagagcagttgagcattttctctcctt |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37644181 |
gacgtgaacgacggctttattacggcgaccttttctcctttcttgcaacgctatggcacttgcatttgattatcagagcagttgagcattttctctcctt |
37644082 |
T |
 |
| Q |
209 |
atcttgtcttattttatacattttgttttggattaaatgagcattttgatgctgaaactgtgaagttt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
37644081 |
atcttgtcttattttatacattttgttttggattaaacgagcattttgatgctgaaagtgtgaagttt |
37644014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University