View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10167_low_30 (Length: 290)
Name: NF10167_low_30
Description: NF10167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10167_low_30 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 72 - 290
Target Start/End: Complemental strand, 41044069 - 41043860
Alignment:
| Q |
72 |
caattaaaccggttcaactcgaaagccggccgagtcaccagtttttaccggttcatgccggttctgaccgattcttactgggccaattacatggccaatc |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
41044069 |
caattaaaccggttcaactcgaaagccggccgagtcaccggtttttaccggttcatgccggttctgaccgattcttactgggccaattacattgccgatc |
41043970 |
T |
|
| Q |
172 |
tgactatctgctcggcccggtctacccaccggtttccggtctgaccggtccgaccggacaggtcgagctgagtttcaaaactatgcttctggtcgctaac |
271 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41043969 |
tgactatctgctcgacccggtctacccaccggtttcc---------ggtccgaccggacgggtcgaactgagtttcaaaactatgcttctggtcgctaac |
41043879 |
T |
|
| Q |
272 |
atatgtaaaacttcacatt |
290 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41043878 |
atatgtaaaacttcacatt |
41043860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 16 - 53
Target Start/End: Complemental strand, 41044124 - 41044087
Alignment:
| Q |
16 |
aggaacataaagaaaagatgtcgtttttctgattaagc |
53 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
41044124 |
aggaacataaaggaaagatgccgtttttctgattaagc |
41044087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 188 - 256
Target Start/End: Original strand, 6273963 - 6274031
Alignment:
| Q |
188 |
ccggtctacccaccggtttccggtctgaccggtccgaccggacaggtcgagctgagtttcaaaactatg |
256 |
Q |
| |
|
|||| ||||||||||||| |||| ||||||||| ||||| | | |||||| |||||||||||||||| |
|
|
| T |
6273963 |
ccggcctacccaccggttcacggttcgaccggtccaaccggccggttcgagccgagtttcaaaactatg |
6274031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 72 - 254
Target Start/End: Complemental strand, 37547547 - 37547366
Alignment:
| Q |
72 |
caattaaaccggttcaactcgaaagccggccgagtcaccagtttttaccggttcatgccggttctgaccgattcttactgggccaattacatggccaatc |
171 |
Q |
| |
|
||||||||| ||||||||||||| ||| |||||||||| ||||||||||||| ||| |||||||||| |||||||||||||||||||||||| || ||| |
|
|
| T |
37547547 |
caattaaactagttcaactcgaaaaccgtccgagtcaccggtttttaccggtttatgtcggttctgactgattcttactgggccaattacatgaccgatc |
37547448 |
T |
|
| Q |
172 |
tgactatctgctcggcccggtctacccaccggtttccggtctgaccggtccgaccggacaggtcgagctgagtttcaaaacta |
254 |
Q |
| |
|
|||||||||||||| || |||||||| ||||| |||| |||||||||||||||||| | |||||| | |||||| ||||||| |
|
|
| T |
37547447 |
tgactatctgctcgacctggtctacctaccgg-ttcctgtctgaccggtccgaccgatcgggtcgaaccgagttttaaaacta |
37547366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 16 - 53
Target Start/End: Complemental strand, 37547604 - 37547567
Alignment:
| Q |
16 |
aggaacataaagaaaagatgtcgtttttctgattaagc |
53 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
37547604 |
aggaacataaagaaaagatgccttttttctgattaagc |
37547567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 113 - 205
Target Start/End: Original strand, 4391352 - 4391444
Alignment:
| Q |
113 |
tttttaccggttcatgccggttctgaccgattcttactgggccaattacatggccaatctgactatctgctcggcccggtctacccaccggtt |
205 |
Q |
| |
|
||||||||| |||||||||| ||||| ||||||| | ||||||||| |||||||| |||||| | ||||||| ||||||||||||| ||||| |
|
|
| T |
4391352 |
tttttaccgattcatgccggctctgatcgattctcattgggccaatcacatggccgatctgatttcctgctcgacccggtctacccatcggtt |
4391444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 129 - 225
Target Start/End: Original strand, 21096528 - 21096624
Alignment:
| Q |
129 |
ccggttctgaccgattcttactgggccaattacatggccaatctgactatctgctcggcccggtctacccaccggtttccggtctgaccggtccgac |
225 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||| |||| | | |||||| |||||||||| || ||||| |||||| || |||||||| |
|
|
| T |
21096528 |
ccggttctcaccgattcttatcgggccaattacatggccgatctaattgcttgctcgacccggtctactcatcggttcccggtcaaactggtccgac |
21096624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 138 - 174
Target Start/End: Complemental strand, 33702797 - 33702761
Alignment:
| Q |
138 |
accgattcttactgggccaattacatggccaatctga |
174 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
33702797 |
accggttcttattgggccaattacatggccaatctga |
33702761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University