View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10167_low_41 (Length: 250)
Name: NF10167_low_41
Description: NF10167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10167_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 9 - 231
Target Start/End: Original strand, 20190244 - 20190466
Alignment:
| Q |
9 |
gagaagcatagggaaattggatcaaggaacttttttatgtgtccaaagaagcttgaagaaagtgacaatggtggagactgtaacgtaacggcgtcgttta |
108 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20190244 |
gagaagcttagggaaattggatcaaggaacttttttatgtgtccaaagaaacttgaagaaagtgacaatggtggagaccgtaacgtaacggcgtcgttta |
20190343 |
T |
 |
| Q |
109 |
gttcatgttccagacaagttgaaaaagtgagcaaaggttttggtcttttaaagtgtatagatttcttgctatgaaatgattgggtgagaacaaaacaaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20190344 |
gttcatgttccagacaagttgaaaaagtgagcaaaggttttggtcttttaaagtgtatagatttcttgctatgaaatgattgggtgagaacaaaacaaat |
20190443 |
T |
 |
| Q |
209 |
caccacttgccaatgctgccaaa |
231 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
20190444 |
caccacttgccaatgctgccaaa |
20190466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University