View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10167_low_46 (Length: 248)
Name: NF10167_low_46
Description: NF10167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10167_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 4 - 241
Target Start/End: Original strand, 26322280 - 26322515
Alignment:
| Q |
4 |
catcatgagattagcaaacaaattaattaattcaattattaaccattgtt-gtcgtatttacgctaactactacccttannnnnnnnnnnnnnnnaataa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
26322280 |
catcatgagattagcaaacaaattaattaattcaattatcaaccattgtttgtcgtatttacgctaactactacccttattaattttttttttt-aataa |
26322378 |
T |
 |
| Q |
103 |
acttcccttattaatctattatatacgctcttttgtcatagaaaaataagtatatatatatgtcattgtaacatttgacttattaaacttccctttcttg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26322379 |
acttcccttattaatctattatatacgctcttttgtcatagaaaaataagtata--tatatgtcattgtaacatttgacttattaaacttccctttcttg |
26322476 |
T |
 |
| Q |
203 |
taagttgatttttacttttaaattatatttgtacctatg |
241 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26322477 |
taagttgatttttacttttagattatatttgtacctatg |
26322515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University