View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10167_low_50 (Length: 243)
Name: NF10167_low_50
Description: NF10167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10167_low_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 6751727 - 6751547
Alignment:
| Q |
18 |
caaaatacagttaaatattcaatttaatggccattttgagtgtaaaatgcaatagcattctgtgtcaagtatttcacccaacataatcgcannnnnnnng |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6751727 |
caaaatacagttaa-tattcaatttaatggccattttgagtgtaaaatgcaatagcattctgtgtcaagtatttcacccaacataatcgcattttttttg |
6751629 |
T |
 |
| Q |
118 |
ttgagataatcacacgttttgttaatatgatctacttgccaattcaaattgaacaaataaaaattggcaacctataataaca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6751628 |
ttgagataatcacacgttttgttaatatgatctacttgccaattcaaattgaacaaataaaaattggcaacctataataaca |
6751547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University