View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10167_low_60 (Length: 236)
Name: NF10167_low_60
Description: NF10167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10167_low_60 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 11 - 219
Target Start/End: Complemental strand, 32116762 - 32116554
Alignment:
| Q |
11 |
agcataggcacttatatcttcctcactttttgcaaaattaaaatcctttacctgaaattaaatatttcatataagttttatcttaagttgtacaaacatt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32116762 |
agcataggcacttatatcttcctcactttttgcaaaattaaaatcctttacttgaaattaaatatttcatataagttttatcttaagttgtacaaacatt |
32116663 |
T |
|
| Q |
111 |
taaactcaaagttgcactacgagtgaggtagctaggtaaccgtatatttcttctggtaaaaaagttgaaaaataaatgaagggaaagagtgagaaactat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32116662 |
taaactcaaagttgcactacgagtgaggtagctaggtaaccgtatatttcttctggtaaaaaagttgaaaaataaatgaaaggaaagagtgagaaactat |
32116563 |
T |
|
| Q |
211 |
ggccaatgt |
219 |
Q |
| |
|
||||||||| |
|
|
| T |
32116562 |
ggccaatgt |
32116554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 11 - 106
Target Start/End: Complemental strand, 31828329 - 31828231
Alignment:
| Q |
11 |
agcataggcacttatatcttcctcactttttgcaaaatta---aaatcctttacctgaaattaaatatttcatataagttttatcttaagttgtacaaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||| ||||||| | ||||||| |||| |
|
|
| T |
31828329 |
agcataggcacttatatcttcctcactttttgcaatattattaaaatcctttacctgaaaataaatatttcatatatgttttatttgaagttgttcaaa |
31828231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 75
Target Start/End: Complemental strand, 39160612 - 39160548
Alignment:
| Q |
11 |
agcataggcacttatatcttcctcactttttgcaaaattaaaatcctttacctgaaattaaatat |
75 |
Q |
| |
|
|||||| || |||||||||||||| |||| ||||| ||| ||||||| ||||||||| ||||||| |
|
|
| T |
39160612 |
agcataagcgcttatatcttcctcgctttctgcaatattgaaatcctctacctgaaaataaatat |
39160548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University