View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10168_low_12 (Length: 218)
Name: NF10168_low_12
Description: NF10168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10168_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 5 - 200
Target Start/End: Original strand, 4073386 - 4073585
Alignment:
| Q |
5 |
gttccaccccataactataatggcataaatatgtatacgtactcctctacgatttttcaataatatttttctatcaagttgcttgacaaaaaataaggca |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4073386 |
gttccaccccataactataatggcataaatatgtatacgtactcctctatgatttttcaataatatttttctatcaagttgcttgacaaaaaataaggca |
4073485 |
T |
|
| Q |
105 |
acaaaaacgtagaccgtacgaatcaaacatgatgattgagatccaacggtggtgttacttgtttttcttgagt----aaactaccaccaaatagatcatt |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
4073486 |
acaaaaacgtagaccgtacgcatcaaacatgatgattgagatccaacggtggtgttacttgtttttcttgagtaaacaaactaccaccaaataaatcatt |
4073585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University