View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10168_low_7 (Length: 250)
Name: NF10168_low_7
Description: NF10168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10168_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 17883209 - 17883450
Alignment:
| Q |
1 |
gtgcaaagtagaaaacttcaaggaccttcaacaaggaaatttaattataatcgcatgaaacaaaatccagatatagttgtagcatttatttcaaaaaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17883209 |
gtgcaaagtagaaaacttcaaggaccttcaacaaggaaatttaattataatcgcatgaaacaaaatccagatatagttgtagcatttatttcaaaaaagg |
17883308 |
T |
 |
| Q |
101 |
aggaatttgattgcaatagtatggataaaagatacctggattggcctatatgctgaacactcaaagtatgcttcaatctcgtggaactgtagcattattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17883309 |
aggaatttgattgcaatagtatggataaaagatacctggattagcctatatgctgaacactcaaagtatgcttcaatctcgtggaactgtagcattattt |
17883408 |
T |
 |
| Q |
201 |
gcgacatcccatgttctagattttcctgctgattttcatctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17883409 |
gcgacatcccatgttctagattttcctgctgattttcatctc |
17883450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 15017899 - 15017945
Alignment:
| Q |
1 |
gtgcaaagtagaaaacttcaaggaccttcaacaaggaaatttaatta |
47 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
15017899 |
gtgcaaagaagaaaacttcccggaccttcaacaaggaaacttaatta |
15017945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 88 - 242
Target Start/End: Complemental strand, 36873805 - 36873651
Alignment:
| Q |
88 |
atttcaaaaaaggaggaatttgattgcaatagtatggataaaagatacctggattggcctatatgctgaacactcaaagtatgcttcaatctcgtggaac |
187 |
Q |
| |
|
||||||| ||||||||||| | |||||||||||||| || |||||||||||||| ||||| |||| |||||||| | | | | |||||||||| ||||| |
|
|
| T |
36873805 |
atttcaacaaaggaggaatctcattgcaatagtatgaatgaaagatacctggataagcctagatgccgaacactcgatgcaagtttcaatctcgcggaac |
36873706 |
T |
 |
| Q |
188 |
tgtagcattatttgcgacatcccatgttctagattttcctgctgattttcatctc |
242 |
Q |
| |
|
||| |||||||| |||||||| | |||||||| | |||||||||||||||||| |
|
|
| T |
36873705 |
tgttgcattattggcgacatcacctgttctaggctcacctgctgattttcatctc |
36873651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University