View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10169_high_1 (Length: 317)
Name: NF10169_high_1
Description: NF10169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10169_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 8 - 308
Target Start/End: Complemental strand, 10599118 - 10598818
Alignment:
| Q |
8 |
atatgctagcctgttgagtggtgctgcttgtattggtacaataggtaagggtgaacaaattcatgccatggtggtgaagatgggatttcggactgaccta |
107 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||||| || |
|
|
| T |
10599118 |
atatgctagcctcttgagtggtgctgcttgtattggtacaattggtaagggtgaacaaattcatgccatggtggttaagattggatttcggactgactta |
10599019 |
T |
 |
| Q |
108 |
agtgttaataatgctttgatctctatgtattctaagtgtggaaacaaagaagctgctttacaggtctttaatgacatggaagatcgcaatgtcataactt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10599018 |
agtgttaataatgctttgatctctatgtattccaagtgtggaaacaaagaagctgctttacaggtctttaatgacatggaagattgcaatgtcataactt |
10598919 |
T |
 |
| Q |
208 |
ggacctctatcataaatggttttgcaaaacatgggtttgctacaaaagcactagaattgttctatgatatgctcaaaacaggtgtgaaacctaatgatgt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||| ||||||||||||| ||||||||||| |
|
|
| T |
10598918 |
ggacctctatcataaatggttttgcaaaacatggatttgcttcaaaagcactagaattgttctataatatgcttgaaacaggtgtgaagcctaatgatgt |
10598819 |
T |
 |
| Q |
308 |
c |
308 |
Q |
| |
|
| |
|
|
| T |
10598818 |
c |
10598818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University