View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10169_high_2 (Length: 236)
Name: NF10169_high_2
Description: NF10169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10169_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 41742724 - 41742783
Alignment:
| Q |
1 |
gactcagcttaattcctcacaaaattctcatgacctaatttagattcgataaagattaat |
60 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41742724 |
gactcagtttaattcctcacaaaattctcatgacctaatttagattcgataaagattaat |
41742783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 142
Target Start/End: Original strand, 41743488 - 41743526
Alignment:
| Q |
104 |
tcaaaggttaattttgatatttgttacaggaattccttt |
142 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
41743488 |
tcaaagattaattttgatatttgttacaggaatttcttt |
41743526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University