View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10169_high_2 (Length: 236)

Name: NF10169_high_2
Description: NF10169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10169_high_2
NF10169_high_2
[»] chr5 (2 HSPs)
chr5 (1-60)||(41742724-41742783)
chr5 (104-142)||(41743488-41743526)


Alignment Details
Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 41742724 - 41742783
Alignment:
1 gactcagcttaattcctcacaaaattctcatgacctaatttagattcgataaagattaat 60  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
41742724 gactcagtttaattcctcacaaaattctcatgacctaatttagattcgataaagattaat 41742783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 142
Target Start/End: Original strand, 41743488 - 41743526
Alignment:
104 tcaaaggttaattttgatatttgttacaggaattccttt 142  Q
    |||||| ||||||||||||||||||||||||||| ||||    
41743488 tcaaagattaattttgatatttgttacaggaatttcttt 41743526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University