View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10169_low_4 (Length: 249)

Name: NF10169_low_4
Description: NF10169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10169_low_4
NF10169_low_4
[»] chr3 (2 HSPs)
chr3 (2-161)||(41443750-41443910)
chr3 (203-242)||(41443952-41443991)


Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 2 - 161
Target Start/End: Original strand, 41443750 - 41443910
Alignment:
2 gatcaactatattaaaaacatggtttactcaaatgacattttagtgagttgtggaaactcaagaagaataaaaaatactannnnnnnaaagaaagaataa 101  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||    
41443750 gatcaactatattaaaaacatggtttactcaaatgacattttagtgagttgtggaaactcaagaagaataaaaaatactatttttttaaagaaagaataa 41443849  T
102 caaat-aaatattcaaatcttgaaaacaaaatatattatgagctgtggaatattgatgaag 161  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41443850 caaataaaatattcaaatcttgaaaacaaaatatattatgagctgtggaatattgatgaag 41443910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 203 - 242
Target Start/End: Original strand, 41443952 - 41443991
Alignment:
203 ttggatgtcgttggttttcactcgttttctctctctgctt 242  Q
    ||||||||||||||||||||||||||||||||||||||||    
41443952 ttggatgtcgttggttttcactcgttttctctctctgctt 41443991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University