View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1016_low_12 (Length: 248)
Name: NF1016_low_12
Description: NF1016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1016_low_12 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 147 - 248
Target Start/End: Complemental strand, 51866692 - 51866591
Alignment:
| Q |
147 |
gattgagtgaataatcaaaagagataaggagatgttagttttaacttttaattcaattttgataagttttaattcaagnnnnnnnggatcaaaacatgtt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51866692 |
gattgagtgaataatcaaaagagataaggagatgttagttttaacttttaattcaagtttgataagttttaattcaagtttgtttggatcaaaacatgtt |
51866593 |
T |
|
| Q |
247 |
ta |
248 |
Q |
| |
|
|| |
|
|
| T |
51866592 |
ta |
51866591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 70
Target Start/End: Complemental strand, 51866847 - 51866806
Alignment:
| Q |
29 |
agagtggacattcatttcaatgtcttttggtctgatttaccc |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51866847 |
agagtggacattcatttcaatgtcttttggtcatatttaccc |
51866806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University