View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1016_low_7 (Length: 289)
Name: NF1016_low_7
Description: NF1016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1016_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 30 - 260
Target Start/End: Original strand, 40708092 - 40708328
Alignment:
| Q |
30 |
tgaaaggcgttgtttactccaaacctggtccacccattttgtgatgctgatgaaccttaacatcatctctcactttattattggggaagcatgcaatgca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40708092 |
tgaaaggcgttgtttactccaaacctggtccacccattttgtgatgctgatgaaccttaacatcatctctcactttattattggggaagcatgcaatgca |
40708191 |
T |
|
| Q |
130 |
ttagcgagctaaaaaggcagtgaaaagtgaagacagtgagaattatgagttttgcaatgcaatgctcaaa------ctatggctatggctatggctattc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40708192 |
ttagcgagctaaaaaggcagtgaaaagttaagacagtgagaattatgagttttgcaatgcaatgctcaaactatggctatggctatggctatggctattc |
40708291 |
T |
|
| Q |
224 |
ttctttttgtgtccctcgtcaattcaccccaacacct |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40708292 |
ttctttttgtgtccctcgtcaattcaccccaacacct |
40708328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University