View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1017-INSERTION-1 (Length: 216)
Name: NF1017-INSERTION-1
Description: NF1017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1017-INSERTION-1 |
 | |
|
| [»] scaffold0019 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0019 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 8 - 105
Target Start/End: Original strand, 107718 - 107815
Alignment:
| Q |
8 |
gtaactagttagattcaattatttgattttctccaattatcataggtgtcgacgtgtcaatgtttcccgtgtccgtgtttcatatatctctaatgttg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
107718 |
gtaactagttagattcaattatttgattttctccaattatcataggtgtcgacgtgtcaatgtttcccgtgtccgtgtttcatatatctctaatgttg |
107815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 137 - 216
Target Start/End: Original strand, 107849 - 107928
Alignment:
| Q |
137 |
gaatcaggttatatatctattttttgaaaattgaaaaagtgtataaagataaaaataatccattcacttgatatatctaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
107849 |
gaatcaggttatatatctattttttgagaattaaaaaagtgtataaagataaaaataatccaatcacttgatatatctaa |
107928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University