View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| ||||||||||||||||
Alignment Overview
Query: NF1017-INSERTION-10 (Length: 109)
Name: NF1017-INSERTION-10
Description: NF1017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| |||||
| |||||
| ||||||
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 5e-44; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 5e-44
Query Start/End: Original strand, 8 - 109
Target Start/End: Original strand, 42204780 - 42204881
Alignment:
| Q | 8 | gggcggtcatggctgctgttactgtcggcagttgctattgttttcctgttggtgcgttcgggtgctggtgctgtctgttttgaggagaggtcgagttttt | 107 | Q |
| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | ||||
| T | 42204780 | gggcggttgtggctgctgttactgtcggcagttgctattgttttcctgttggtgcgttcgggtgctggtgctgtctgttttgaggagaggtcaagttttt | 42204879 | T |
 | ||||
| Q | 108 | tg | 109 | Q |
| || | ||||
| T | 42204880 | tg | 42204881 | T |
| ||||
Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.0000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.0000000000006
Query Start/End: Original strand, 8 - 61
Target Start/End: Original strand, 21266552 - 21266605
Alignment:
| Q | 8 | gggcggtcatggctgctgttactgtcggcagttgctattgttttcctgttggtg | 61 | Q |
| |||||| | |||||||||||||||||||||| |||||| ||||||||||||||| | ||||
| T | 21266552 | gggcggccgtggctgctgttactgtcggcagctgctatagttttcctgttggtg | 21266605 | T |
| ||||
Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University