View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10170_high_7 (Length: 240)
Name: NF10170_high_7
Description: NF10170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10170_high_7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 2688180 - 2687958
Alignment:
| Q |
18 |
ctatcttccggtttcgttgtgtttcggctgggggctggcatttttgctgggtttagtgttgctatcatgacagtacagcaggtgtaggtggtgctgcctg |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2688180 |
ctatcttccggtttcattgtgtttcggctgcgggctggcatttttgctgggtttagtgttgctgtcatgacagtacagcaggtgtaggtgctgctgcctg |
2688081 |
T |
|
| Q |
118 |
tctgctgcgcagctgattgttggttttttggcttctggagccgctgttcggttttgggagatgtgctgggactgtttcgggttggtttagggatcgctag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2688080 |
tctgctgcgcagctgattgttggttttttggcttctggagctgctgtttggttttgggagatgtgctgggactgtttcgggttggtttagggatcgctag |
2687981 |
T |
|
| Q |
218 |
gggcttgaattttgatgtgattt |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2687980 |
gggcttgaattttgatgtgattt |
2687958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 231
Target Start/End: Complemental strand, 52422091 - 52422030
Alignment:
| Q |
170 |
tttgggagatgtgctgggactgtttcgggttggtttagggatcgctaggggcttgaattttg |
231 |
Q |
| |
|
|||||||| |||| |||| ||||| |||||||||||||| || ||||||||||||||||||| |
|
|
| T |
52422091 |
tttgggagctgtgatggggctgttgcgggttggtttaggcatagctaggggcttgaattttg |
52422030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 231
Target Start/End: Complemental strand, 42851821 - 42851760
Alignment:
| Q |
170 |
tttgggagatgtgctgggactgtttcgggttggtttagggatcgctaggggcttgaattttg |
231 |
Q |
| |
|
|||||||| |||| |||| ||||| |||||||||||||| || |||||| |||||||||||| |
|
|
| T |
42851821 |
tttgggagctgtgatggggctgttgcgggttggtttaggcatagctaggagcttgaattttg |
42851760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University