View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10170_high_9 (Length: 239)
Name: NF10170_high_9
Description: NF10170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10170_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 4569804 - 4569583
Alignment:
| Q |
1 |
ccgtaaactacctcgacgacgacccatcttcccattttgttgaacagttagtacccgacccaaaaccggaagaaggattaaaccatccatgcatgcttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4569804 |
ccgtaaactacctcgacgacgacccatcttcccattttgttgaacagttagtacccgacccaaaaccggaagaaggattaaaccatccatgcatgcttca |
4569705 |
T |
|
| Q |
101 |
actcactgtttacaagtgcggtgggttcactctcggtgcagcaattcaccattcactttgtgatggaatgggtgggacgcnnnnnnncaacacgatggcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4569704 |
actcactgtttacaagtgcggtgggttcactctcggtgcagcaattcaccattcactttgtgatggaatgggtgggacgctttttttcaacacgatggcg |
4569605 |
T |
|
| Q |
201 |
gagttggctcgtggcggggaac |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
4569604 |
gagttggctcgtggcggggaac |
4569583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University