View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10170_low_16 (Length: 248)
Name: NF10170_low_16
Description: NF10170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10170_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 46752258 - 46752014
Alignment:
| Q |
1 |
aggtttagcaaggctctccaccactgactttggattttagatgtctttttctaaagaaatcttatttcatgagattagtctccatagttaaatgtgcaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46752258 |
aggtttagcaaggctctccaccactgactttggattttagatgtcttgttataaagaaatcttgtttcatgagattagtctccatagttaaatgtgcaga |
46752159 |
T |
 |
| Q |
101 |
ttaattaagttataataatgatttcggttaaaaattgaagtcgtgactagatgctgcttaacacat-cccatcccacatctaataatctgtcaatactac |
199 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
46752158 |
ttaattaagttataataatcatttcggttaaaaattgaagtcgtgactagatgctgcttaacacatacacatcccacatctaataatctgtcaatactac |
46752059 |
T |
 |
| Q |
200 |
gttggt----gaaacataagtgatatgaatatgttttgcctttgctt |
242 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
46752058 |
gttggtgaaagaaacataagtgatatga--atgttttgcttttgctt |
46752014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University