View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10170_low_19 (Length: 240)

Name: NF10170_low_19
Description: NF10170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10170_low_19
NF10170_low_19
[»] chr5 (1 HSPs)
chr5 (18-240)||(2687958-2688180)
[»] chr3 (1 HSPs)
chr3 (170-231)||(52422030-52422091)
[»] chr4 (1 HSPs)
chr4 (170-231)||(42851760-42851821)


Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 2688180 - 2687958
Alignment:
18 ctatcttccggtttcgttgtgtttcggctgggggctggcatttttgctgggtttagtgttgctatcatgacagtacagcaggtgtaggtggtgctgcctg 117  Q
    ||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||    
2688180 ctatcttccggtttcattgtgtttcggctgcgggctggcatttttgctgggtttagtgttgctgtcatgacagtacagcaggtgtaggtgctgctgcctg 2688081  T
118 tctgctgcgcagctgattgttggttttttggcttctggagccgctgttcggttttgggagatgtgctgggactgtttcgggttggtttagggatcgctag 217  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
2688080 tctgctgcgcagctgattgttggttttttggcttctggagctgctgtttggttttgggagatgtgctgggactgtttcgggttggtttagggatcgctag 2687981  T
218 gggcttgaattttgatgtgattt 240  Q
    |||||||||||||||||||||||    
2687980 gggcttgaattttgatgtgattt 2687958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 231
Target Start/End: Complemental strand, 52422091 - 52422030
Alignment:
170 tttgggagatgtgctgggactgtttcgggttggtttagggatcgctaggggcttgaattttg 231  Q
    |||||||| |||| |||| ||||| |||||||||||||| || |||||||||||||||||||    
52422091 tttgggagctgtgatggggctgttgcgggttggtttaggcatagctaggggcttgaattttg 52422030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 231
Target Start/End: Complemental strand, 42851821 - 42851760
Alignment:
170 tttgggagatgtgctgggactgtttcgggttggtttagggatcgctaggggcttgaattttg 231  Q
    |||||||| |||| |||| ||||| |||||||||||||| || |||||| ||||||||||||    
42851821 tttgggagctgtgatggggctgttgcgggttggtttaggcatagctaggagcttgaattttg 42851760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University