View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10170_low_20 (Length: 239)
Name: NF10170_low_20
Description: NF10170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10170_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 49866929 - 49867149
Alignment:
| Q |
1 |
ctaaagctgcagtaaaatacaacaggtgtagaaataattagatttagggagagaaaaatgattggtcacctgagctatcttacaagtaatggcatgtcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49866929 |
ctaaagctgcagtaaaatacaacaggtgtagaaataattagatttagggagagaaaaatgattggttacctgagctatcttacaagtaatggcatgtcca |
49867028 |
T |
|
| Q |
101 |
tcagttccccacccttgaatgttttgaaacaaaaacatgaatgagactatggtcactaaaatgattttgttatgctccattttgttttcttaacagaacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49867029 |
tcagttccccacccttgaatgttttgaaacaaaaacatgaatgagattatggttactaaaatgattttgttatgctccattttgttttcttaacagaacc |
49867128 |
T |
|
| Q |
201 |
gtgcaaattatgttcttgcta |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
49867129 |
gtgcaaattatgttcttgcta |
49867149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 117
Target Start/End: Original strand, 23136061 - 23136111
Alignment:
| Q |
67 |
cacctgagctatcttacaagtaatggcatgtccatcagttccccacccttg |
117 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
23136061 |
cacctgagcaatcttacaaacaatggcatgtccatcatctccccacccttg |
23136111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University