View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10170_low_21 (Length: 239)
Name: NF10170_low_21
Description: NF10170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10170_low_21 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 34760320 - 34760113
Alignment:
| Q |
17 |
taatcatgttgtaaattatggttaattgtgttttttagttgcgttaacaatccaaattgtgcattcatttacgaggaaaatctttgcctctaatttttct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34760320 |
taatcatgttgtaaattatggttaattgtgttttttagttgcgttaacaatccaaattgtgcattcatttacgaggaaaatctttgcctctaatttttct |
34760221 |
T |
 |
| Q |
117 |
ttcattccccacattttctttcccagaaagaaaagaacagcactaccttaacagacagtgaagggacatcaccacttgtgtttgtttgtctcttatttgt |
216 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
34760220 |
ttcat---------------tcccagaaagaaaagaacagcactaccttaacagacagtgaagggacatcaccacttatgtttgtttgtctcttgtttgt |
34760136 |
T |
 |
| Q |
217 |
tcagaaaagtaatatcaaaatcc |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34760135 |
tcagaaaagtaatatcaaaatcc |
34760113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University