View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10170_low_24 (Length: 238)
Name: NF10170_low_24
Description: NF10170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10170_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 15 - 223
Target Start/End: Original strand, 3149248 - 3149460
Alignment:
| Q |
15 |
caaaggtcaggcctaaagtattaatcaagtcggttcttcaatcaataccaatttattttatgagtttgtttactcttccgatgactttatgcaatgggat |
114 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
3149248 |
caaaggtcaggccaaaagtattaatcaagtcggttcttcaatcaataccaacttattttatgagtttgtttactcttccaatgactttatgcgatgggat |
3149347 |
T |
|
| Q |
115 |
tgaaaaaataataaacttcttttagtggggtcatttaggggcccaaagcaaatgaataaattgattgtc--ttcgtataagccatctatg--caaaagaa |
210 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||| ||||||| |||||||||||||| |||||| |||||||||| ||||||| |||| || |
|
|
| T |
3149348 |
tgaaaaaatgataaacttcttttagtggggtcattcaggagcccaaaacaaatgaataaattaattgtcttttcgtataagttatctatgaaaaaaaaaa |
3149447 |
T |
|
| Q |
211 |
aaatggagggatg |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3149448 |
aaatggagggatg |
3149460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University