View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10170_low_25 (Length: 235)
Name: NF10170_low_25
Description: NF10170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10170_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 25 - 217
Target Start/End: Original strand, 29761589 - 29761781
Alignment:
| Q |
25 |
cacaataaaaatacgaagagtttgccttatgattgtaccatataaagtgtgttagtgcattttaatatagatgatgaactaacaacatgtggacacaata |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29761589 |
cacaataaaaatacgaagagtttgccttatgattgtaccatataaagtgtgttagagcattttaatatagatgatgaactaacaacatgtggacacaata |
29761688 |
T |
|
| Q |
125 |
agatgggaaaatgaaattctaatactatggaataatgaccctgtgcacttaactaaattctcacggcaaatgtggaagcaaggatggtgaaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29761689 |
agatgggaaaatgaaattctaatactatggaataatgaccctgtgcacttaactaaattctcacggcaaatgttgaagcaaggatggtgaaat |
29761781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University