View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10171_low_6 (Length: 261)
Name: NF10171_low_6
Description: NF10171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10171_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 15632791 - 15632565
Alignment:
| Q |
19 |
attaccatcataaattagtcaaatattggataaattactagggcaatacaaaccaagctgcatatactgatataccacagaca------ggatgcccgac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15632791 |
attaccatcataaattagtcaaatattggataaattactagggcaatacaaaccaagcagcatatactgatataccacagacacagacaggatgcccgac |
15632692 |
T |
|
| Q |
113 |
tccgaccaatctccctcccttgctctcatcgacgcataccctcaaataactccctctcatgctctcctcgtcctcgacaccctcttaatcaagatcttcg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15632691 |
tccgaccaatctccctcccttgctctcatcgacgcatagcctcaaataactccctctcatgctctcctcgtcctcgacaccctcttaatcaagatcttcg |
15632592 |
T |
|
| Q |
213 |
atgtctacttctttactgaagcttgta |
239 |
Q |
| |
|
|||||||||||||||||| |||||||| |
|
|
| T |
15632591 |
atgtctacttctttactggagcttgta |
15632565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University