View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10171_low_7 (Length: 251)

Name: NF10171_low_7
Description: NF10171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10171_low_7
NF10171_low_7
[»] chr3 (1 HSPs)
chr3 (142-244)||(39489843-39489942)


Alignment Details
Target: chr3 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 142 - 244
Target Start/End: Complemental strand, 39489942 - 39489843
Alignment:
142 ttatttatttcttgatgaactgatatgttctaaaatgttgttgtcagtgctactatgtacaattgtggaataagacctacgaaatttgtttgcccctttg 241  Q
    |||||||||||||||||||||||||||||||| ||||||||   || ||| | | |||||||||||||||||||||||||||||||||||||||||||||    
39489942 ttatttatttcttgatgaactgatatgttctacaatgttgt---caatgccattgtgtacaattgtggaataagacctacgaaatttgtttgcccctttg 39489846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University