View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10172_low_3 (Length: 404)
Name: NF10172_low_3
Description: NF10172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10172_low_3 |
 | |
|
| [»] scaffold0229 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 144 - 339
Target Start/End: Original strand, 34771828 - 34772023
Alignment:
| Q |
144 |
gagaatctgggatggttggttgttatgagttataattttgttaatcttattttgtttcagcttatgaaagggaaagacatgagatgacctgcttgtgcaa |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34771828 |
gagaatctgggatggttggttgttatgagttataattttgttaatcttattttgtttcagcttatgaaagggaaagacatgagatgacctgcttgtgcaa |
34771927 |
T |
|
| Q |
244 |
ttataatgatggatggtgcttgtcttgcaaagaaaatcatgaaaagccaaaaaagtcatggcagcaagaagagagggaagctggtgatgaagtagc |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34771928 |
ttataatgatggatggtgcttgtcttgcaaagaaaatcatgaaaagccaaaaaagtcatggcagcaagaagagagggaagctggtgatgaagtagc |
34772023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0229 (Bit Score: 71; Significance: 5e-32; HSPs: 1)
Name: scaffold0229
Description:
Target: scaffold0229; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 16630 - 16548
Alignment:
| Q |
1 |
cttggtggtattttggggaaactcttaacaatcctcggacaccacaattgtgaaacataaacaaagatgaacggaatgctgag |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16630 |
cttggtggtattttggggaaactcttaacaatcctcaaacatcacaattgtgaaacataaacaaagatgaacggaatgctgag |
16548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 71; Significance: 5e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 1401728 - 1401810
Alignment:
| Q |
1 |
cttggtggtattttggggaaactcttaacaatcctcggacaccacaattgtgaaacataaacaaagatgaacggaatgctgag |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1401728 |
cttggtggtattttggggaaactcttaacaatcctcaaacatcacaattgtgaaacataaacaaagatgaacggaatgctgag |
1401810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University