View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10173_low_15 (Length: 251)

Name: NF10173_low_15
Description: NF10173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10173_low_15
NF10173_low_15
[»] chr4 (1 HSPs)
chr4 (13-251)||(10599253-10599491)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 13 - 251
Target Start/End: Complemental strand, 10599491 - 10599253
Alignment:
13 atgaacgggaagctatgagattgtttagcgatatgttgcttcagggttgtgttgcgccaaattgctttacgttttctggtgttcttaaggcttgtgcgag 112  Q
    |||||||||||||||||||| |||||||  ||||||||||||||||| |||||||||| || ||||||||||| || |||||||||||||||||||||||    
10599491 atgaacgggaagctatgagaatgtttagtaatatgttgcttcagggtggtgttgcgccgaactgctttacgttctccggtgttcttaaggcttgtgcgag 10599392  T
113 tcttcctaattttgattttggtgaacaagttcacgggcaaacgattaaattaggtctttctgcgattgattgtgtagggaatggtcttgttagtgtgtat 212  Q
    ||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
10599391 tcttcctgattttgattttggtgaacaggttcatgggcaaacgattaaattaggtctttctgcaattgattgtgtagggaatggtcttgttagtgtgtat 10599292  T
213 gcaaggtctgggagaatggaaggtgctcgcaagtgtttt 251  Q
    |||| |||||| |||||||||  ||||||||||||||||    
10599291 gcaaagtctggaagaatggaatctgctcgcaagtgtttt 10599253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University