View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_high_20 (Length: 266)
Name: NF10174_high_20
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 17 - 252
Target Start/End: Complemental strand, 6672263 - 6672028
Alignment:
| Q |
17 |
ttgccatttattcgtagctattaagtaatccaagaatcaatttagagtaatatatgagtcactagttagtctacaaactaacatgcatgttctgatatag |
116 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6672263 |
ttgccatttattcgtagctattaattaatccaagaatcaatttagagtaatatatgagtcactagttagtctacaaactcacatgcatgttctgatatag |
6672164 |
T |
 |
| Q |
117 |
gtagttgtgaaataatagaggaataacattaagcctaaaaattttccaccactatataaacaatccgaccagatgtgaacttacaccctctccaccaaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6672163 |
gtagttgtgaaataatagaggaataacattaagcctaaaaattttccaccactatataaacaatccgaccagatgtgaacttacaccctctccaccaaat |
6672064 |
T |
 |
| Q |
217 |
ctctccccatctttctcttcaacatggcattgtttc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6672063 |
ctctccccatctttctcttcaacatggcattgtttc |
6672028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 100 - 152
Target Start/End: Original strand, 6624983 - 6625035
Alignment:
| Q |
100 |
tgcatgttctgatataggtagttgtgaaataatagaggaataacattaagcct |
152 |
Q |
| |
|
|||||||||||||||| |||||||||| ||| |||||||||| ||||||||| |
|
|
| T |
6624983 |
tgcatgttctgatataactagttgtgaagtaaaagaggaataatattaagcct |
6625035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University