View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_high_23 (Length: 251)
Name: NF10174_high_23
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_high_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 58 - 240
Target Start/End: Original strand, 51725141 - 51725324
Alignment:
| Q |
58 |
gtcagcttaaccttt-acactttgatgcatgtgccccttgttttcatgagccccaaatggatggtcttaatcttaattgatgcccatgatctagataact |
156 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51725141 |
gtcagcttaaccttttacactttgatgcatgtgccccttgttttcatgagccccaaatggatggtcttaatcttaattgatgcccatgatctagataact |
51725240 |
T |
|
| Q |
157 |
ttagcggtgaatggtgtagaaaatattttaaagtagacattcaaactttaaagtggtccatcaagccatcatcttggtatctct |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51725241 |
ttagcggtgaatggtgtagaaaatattttaaagtagacattcaaactttaaagtggtccatcaagccatcatcttggtatctct |
51725324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 41
Target Start/End: Original strand, 51725095 - 51725123
Alignment:
| Q |
13 |
aaaaaattctttattatagctatcttttt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51725095 |
aaaaaattctttattatagctatcttttt |
51725123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University