View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_high_27 (Length: 249)
Name: NF10174_high_27
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_high_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 4676746 - 4676502
Alignment:
| Q |
1 |
ttaaatattctgtgacaaaatttatttatgcgacttccgaaatcaatgttccggaagcgtttattataaagtctttatctagagaagcttggagtaagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4676746 |
ttaaatattctgtgacaaaatttatttatgcgacttccgaaatcaatgttccggaagcgtttattataaagtctttatctagagaagcttggagtaagga |
4676647 |
T |
|
| Q |
101 |
atcaaattggattggatttgttgctgtggctaatgatgaagggaaagatgtgttggggagaagggatattgtgattgcttggagaggaacgattcaaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4676646 |
atcaaattggattggatttgttgctgtggctaatgatgaagggaaagatgtgttggggagaagggatattgtgattgcttggagaggaacgattcaaaca |
4676547 |
T |
|
| Q |
201 |
ttggaatgggttaatgatcttcagtttcttttggtctctgctcct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4676546 |
ttggaatgggttaatgatcttcagtttcttttggtttctgctcct |
4676502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University