View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10174_high_27 (Length: 249)

Name: NF10174_high_27
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10174_high_27
NF10174_high_27
[»] chr2 (1 HSPs)
chr2 (1-245)||(4676502-4676746)


Alignment Details
Target: chr2 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 4676746 - 4676502
Alignment:
1 ttaaatattctgtgacaaaatttatttatgcgacttccgaaatcaatgttccggaagcgtttattataaagtctttatctagagaagcttggagtaagga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4676746 ttaaatattctgtgacaaaatttatttatgcgacttccgaaatcaatgttccggaagcgtttattataaagtctttatctagagaagcttggagtaagga 4676647  T
101 atcaaattggattggatttgttgctgtggctaatgatgaagggaaagatgtgttggggagaagggatattgtgattgcttggagaggaacgattcaaaca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4676646 atcaaattggattggatttgttgctgtggctaatgatgaagggaaagatgtgttggggagaagggatattgtgattgcttggagaggaacgattcaaaca 4676547  T
201 ttggaatgggttaatgatcttcagtttcttttggtctctgctcct 245  Q
    ||||||||||||||||||||||||||||||||||| |||||||||    
4676546 ttggaatgggttaatgatcttcagtttcttttggtttctgctcct 4676502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University