View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_high_41 (Length: 201)
Name: NF10174_high_41
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_high_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 85 - 187
Target Start/End: Original strand, 3532498 - 3532600
Alignment:
| Q |
85 |
tttttaagatgggtattaaacacatatgaatgtagtttttgtagatatatttgttatctcctttttagtctgccattaaagatgtcttaatctatcccct |
184 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3532498 |
tttttaagatgggtattaaacacatatgatagtagtttttgtagatatatttgttatctcctttttagtctgccattaaagatgtcttaatctatcctct |
3532597 |
T |
|
| Q |
185 |
ttg |
187 |
Q |
| |
|
||| |
|
|
| T |
3532598 |
ttg |
3532600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 3532362 - 3532424
Alignment:
| Q |
18 |
cactatcctttaattgttccataataatttcaaaattacgttgacaatcaaaatgaatgaata |
80 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3532362 |
cactatcctataattgttccataataatttcaaaattacgttgacaatcaaaatgaatgaata |
3532424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University