View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_low_13 (Length: 436)
Name: NF10174_low_13
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 405; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 405; E-Value: 0
Query Start/End: Original strand, 16 - 424
Target Start/End: Complemental strand, 4074135 - 4073727
Alignment:
| Q |
16 |
gttactttccagcatgatgcctttattatttctgaatgatggtattgattttggaaatacagtattctttaattgttttagtgaccactttgattattta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4074135 |
gttactttccagcatgatgcctttattatttctgaatgatggtattgattttggaaatacagtattctttaattgttttagtgaccactttgattattta |
4074036 |
T |
|
| Q |
116 |
ataagacggtctgaacagatatatagacttaacgctaatgatacccactggaatctgatgctaaacttcagttactgcagtgggatagtataacagcagc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4074035 |
ataagacggtctgaacagatatatagacttaacgctaatgatacccactggaatctgatgctaaacttcagttactgcagtgggatagtataacagcagc |
4073936 |
T |
|
| Q |
216 |
gataacttcatataaggatgaatttgaactctcaagaaattaaagacaataagaccctggcaattagagaggcctagttctttcccctctcgcggtttgt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4073935 |
gataacttcatataaggatgaatttgaactctcaagaaattaaagacaataagaccctggcaattagagaggcctagttctttcccctctcgcggtttgt |
4073836 |
T |
|
| Q |
316 |
ttccctctgtcttccagcactctgttgctgccatgtttgcaactaagcattaaacgaggtcacacgtccaacctttgcgtgatatcctaatcccctactg |
415 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4073835 |
ttccctctgtcttccagcactctgttgctgccatgtttgcaactaagcattaaacgaggtcacacgtccaacctttgcgtgatatcccaatcccctactg |
4073736 |
T |
|
| Q |
416 |
taccccctt |
424 |
Q |
| |
|
||||||||| |
|
|
| T |
4073735 |
taccccctt |
4073727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University